Catalyzed reaction/ biological activity
binding to the mRNA of the ''[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'' operon, causes transcription antitermination (in presence of sucrose and absence of glucose)Protein family
[SW|PRD-containing transcription factors|transcriptional antiterminator] bglG family (according to Swiss-Prot) BglG family of antiterminatorsParalogous protein(s)
[protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT], [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY], [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT] [SW|Domains]
N-terminal RNA binding domain [Pubmed|10610766]2 x [SW|PRD] ([protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] regulation domains) [Pubmed|9663674]Modification
Phosphorylated and inactivated by [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|SacP] (EIIScr) (according to Swiss-Prot)Structure
[PDB|1TLV] (the [SW|PRD] domains of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT], corresponds to aa 54 ... 271, 41% identity)Mutant
GP429 (spc), available in [SW|Jörg Stülke]'s labBKE38070 ([gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGGBKK38070 ([gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGGExpression vectors
for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP166, available in [SW|Jörg Stülke]'s labfor expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP426, available in [SW|Jörg Stülke]'s labfor expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP427, available in [SW|Jörg Stülke]'s labfor expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP439, available in [SW|Jörg Stülke]'s labfor expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP440, available in [SW|Jörg Stülke]'s labfor expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP571, available in [SW|Jörg Stülke]'s labfor expression of RNA-binding domain in ''B. subtilis'', in [SW|pBQ200]: pGP446, available in [SW|Jörg Stülke]'s labfor expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with C-terminal Strep-tag, in [SW|pGP382]: pGP1064, available in [SW|Jörg Stülke]'s labfor expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with N-terminal Strep-tag, in [SW|pGP380]: pGP1068, available in [SW|Jörg Stülke]'s labGFP fusion
GP1227 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s labFLAG-tag construct
GP1223 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab